|
|
||||||||
Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614-5804
| ABSTRACT |
|---|
|
|
|---|
Sa gene; genetic hypertension; salt-sensitive hypertension; cardiac hypertrophy
| INTRODUCTION |
|---|
|
|
|---|
Linkage analysis for quantitative traits such as blood pressure yields only a very approximate localization of the locus controlling the trait (quantitative trait locus, QTL). Further analysis usually takes the form of construction of a congenic strain whereby a chromosomal segment from one strain (donor) is introgressed into another strain (recipient) by a backcross breeding scheme. If a variant allele for a blood pressure QTL is present in the chromosomal segment moved, then the resulting congenic strain will have a blood pressure different from the recipient strain. The congenic strategy is critical to 1) confirm or refute initial linkage analysis, and 2) provide better chromosomal localization of the QTL by construction of congenic substrains with progressively smaller introgressed chromosomal segments (25).
We had previously constructed a congenic strain introgressing a large segment of chr 1 from Lewis (LEW) rats into Dahl S rats (5). In agreement with the linkage analysis using S and LEW (7) the introgressed LEW segment lowered blood pressure in the congenic strain compared with S rats. In the present work congenic substrains were constructed and an improved localization of a blood pressure QTL near the center of chr 1 was obtained.
Our initial congenic strain included the Sa gene, which has been proposed as a candidate for influencing blood pressure in SHRs. The Sa gene was discovered by Iwai and Inagami (13) in a screening procedure to detect genes differentially expressed in the kidneys of SHR and Wistar-Kyoto rats (WKY). SHR kidney expressed higher Sa mRNA levels compared with WKY. It was subsequently found that the Sa gene is mainly expressed in the renal proximal tubule (23, 31). The term Sa is arbitrary, and the function of the gene product is unknown. Polymorphisms in the Sa gene were also shown to cosegregate with its differential expression in a population derived from SHR and WKY (27), with the higher expression being associated with the SHR allele. The present work, however, excludes the Sa gene as a candidate for effects on blood pressure in the Dahl S vs. LEW strain comparison because the Sa locus is outside of the newly defined QTL region but was included in a congenic region that had no effect on blood pressure.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Genotyping.
DNA was extracted from a tail biopsy using the QIAamp tissue kit (Qiagen, Valencia, CA). PCR genotyping with microsatellite markers was done as described earlier (7). Markers for the Sa gene were developed previously (8); the Sa marker used is D1Mco13, previously called PSA1.
Blood pressure determination.
We employed an experimental design in which the blood pressure of a congenic strain was compared only to its own separate group of control S rats that were bred, housed, and studied concomitantly. Rats were weaned at 30 days of age to low salt (0.3% NaCl) Harlan Teklad diet 7034 (Madison, WI). Twenty male congenic substrain rats were matched by age and weight with twenty male S control rats and were caged in 10 cages; each cage contained two congenics and two S rats. At 4042 days of age, the rats were fed a 2% NaCl Harlan Teklad diet (TD94217) for 24 days. Systolic blood pressure was measured using the tail-cuff method on conscious restrained rats warmed to 28°C. The operator did not know the identity of the rat during these measurements. Blood pressure was measured on each rat once a day for four consecutive days. The blood pressure value of each day was the average of three to four consistent readings. The final blood pressure value used was the averaged blood pressure value of the 4 days. Rats were killed with CO2, and body and heart weights were measured. Statistical analysis was done using programs from SPSS (Chicago, IL).
Heart weight.
To corroborate the blood pressure data, heart weight was evaluated in two ways: heart weight-to-body weight ratio and heart weight adjusted for body weight. Heart weight-to-body weight ratio has been criticized because it is valid only if the regression of heart weight on body weight passes through the origin (1). In the present experiments such regression lines did pass through the origin in all but one case (Chr1 x 14). We have therefore also calculated heart weight adjusted for body weight using the regression equation relating heart and body weight (28) if the body weights differed between S and a congenic strain.
Marker development.
Microsatellite markers were identified using chromosome 1-sorted DNA as previously described (7, 10), except that the reamplification of the chromosome-sorted DNA was done using Cloned Pfu DNA polymerase from Stratagene (La Jolla, CA) and the PCR products were directly ligated using the zero blunt PCR cloning kit from Invitrogen (San Diego, CA). Clones were screened for CA and CT repeated elements and sequenced using the Thermo Sequenase radiolabeled terminator cycle sequencing kit from Amersham (Arlington Heights, IL). Newly developed markers were placed on the chromosome 1 map by genotyping 92 rats from our previously used F2(S x LEW) population of 151 rats. The chromosome 1 map was constructed using the MAPMAKER/EXP program (19) (http://www.genome.wi.mit.edu/ftp/distribution/mapmaker3/).
RNA analysis.
Kidneys were obtained from 42-day-old male rats fed 0.3% NaCl Teklad rat chow. RNA was extracted from whole kidney homogenate using the Ultraspec-II RNA isolation system from Biotecx Laboratories (Houston, TX). Northern analysis was done with 30 µg of total RNA using standard techniques. Hybridization of filters was done at 42°C using a partial Sa cDNA fragment, bases 12041890 of the published sequence (7, 13), labeled with 32P using the RadPrime DNA labeling system (Life Technologies, Gaithersburg, MD). The filter was also hybridized to 32P-labeled glyceraldehyde 3-phosphate dehydrogenase (G3PDH) to normalize for loading differences among the samples. The G3PDH fragment used as a probe was obtained by PCR amplification of rat genomic DNA using primers from Life Technologies (sense CCATGGAGAAGGCTGGG and antisense CAAAGTTGTCATGGATGACC).
Quantitative analysis of Sa gene expression.
Sa mRNA levels were quantitated using a Hewlett-Packard Scan Jet 3C scanner and NIH Image 1.61 software (Biomedical Magnetic Resonance Laboratory, University of Illinois at Urbana-Champaign). Quantitation was done on the same filter at different time exposures to ensure that the values obtained were not obtained from an overexposed X-ray film. Both Sa and G3PDH mRNA levels were quantitated, and the ratio of Sa to G3PDH was taken for purposes of normalization. The quantitative results obtained from S, Chr1 x 7, and SHR (each with n = 5) were analyzed using SPSS programs (Chicago, IL). A one-way analysis of variance (ANOVA) and a Bonferroni post hoc test (28) were done on the Sa-to-G3PDH ratios to determine significance of the Sa mRNA expression among the three strains tested.
| RESULTS |
|---|
|
|
|---|
|
|
The effect of the introgressed segments on blood pressure, body weight, and heart weight.
Figure 1 and Table 2 show the effects of the congenic strains on blood pressure and heart weight. Other variables measured included body weight, heart weight, and the heart weight-to-body weight ratio (Table 2). A significant blood pressure-lowering effect ranging from 23 ± 5.0 to 38 ± 3.5 mmHg was observed among some of the congenic substrains compared with S rats. The same congenic substrains also showed a lowering effect on heart weight ranging from 49 ± 19.8 to 133 ± 18.6 mg. Two congenic substrains, Chr1 x 7 and Chr1 x 15, did not show a significant blood pressure effect compared with the control S rats. The heart weight effect observed was not significant for Chr1 x 7, whereas Chr1 x 15 showed a significant increase in heart weight. The body weight effects observed among the congenic substrains were not significant except for Chr1 x 14 and Chr1 x 15, which showed a significant increase in body weight of 13 ± 3.5 and 10 ± 4.2 g, respectively, compared with the control S rats.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The original congenic strain was constructed to try to include possible multiple QTLs because linkage analysis had suggested more than one blood pressure QTL on chromosome 1 (5, 7, 30). The blood pressure-lowering effect of 34 mmHg (Fig. 1 and Table 2) observed using the S.LEW(chr 1) congenic strain confirmed that at least one QTL was trapped within this chromosomal region. Similar data on S.LEW(chr1) were reported previously (5), but the data in Table 2 represent an additional test on this strain. The present analysis (Fig. 1) using congenic substrains derived from S.LEW(chr1) allowed for the localization of a blood pressure QTL to the 25-cM region flanked by D1M7Mit87 and D1N64. The QTL was conservatively localized to this region as the difference between congenic substrains Chr1 x 8 and Chr1 x 15. One could argue that the QTL is likely to be in the D1M7Mit87 to D1Wox6 (15 cM) region, because this region is common to the two substrains Chr1 x 8 and Chr1 x 14, both of which showed a significant blood pressure effect. This argument is not technically complete based only on the data in Fig. 1 because theoretically there could be another QTL in Chr1 x 14 between D1Mco2 and D1M7Mit87 that accounts for the blood pressure effect of Chr1 x 14. Preliminary unpublished data (Saad and Rapp) on other congenic strains indicate, however, that the second blood pressure QTL on chr 1 suggested by linkage analysis (5, 7) is located more proximally between D1Uia8 and D1Rat95.
It is obvious in Table 2 that there is significant variation in the blood pressure of S rats among experiments. Because S rats have been inbred for more than 75 generations of brother-sister mating, they should be highly genetically homogeneous. Variation among S rat groups studied at different times is attributed to unknown environmental influences. On the assumption that such environmental influences affect the S and congenic strains similarly, the only valid comparison in determining if a congenic strain has a different blood pressure compared with the S strain is between the S and congenic strains raised and studied concomitantly.
We also measured body and heart weights of our congenic substrains. There was no significant strain difference in body weight with the exception of substrains Chr1 x 14 and Chr1 x 15. These showed a significant increase in body weight of 13 and 10 g, respectively, compared with S. These effects were not great enough to warrant further study. In most of the congenic substrains a decrease in blood pressure correlated well with a decrease in heart weight compared with S rats as measured by either heart weight-to-body weight ratio or by heart weight adjusted (if necessary) by regression for differences in body weight (Fig. 1 and Table 2). Changes in heart weight are presumably largely a consequence of changes in blood pressure (afterload). Congenic substrain Chr1 x 15 had no significant effect on blood pressure, but heart weight (adjusted for differences in body weight) was increased compared with the S. This was not reflected in the heart weight-to-body weight ratio, and so the increased heart weight in Chr1 x 15 is problematic. Clearly, heart weight in Chr1 x 15 is not decreased as would be expected if the strain included the blood pressure QTL. It could be that the Chr1 x 15 congenic region contains a heart weight QTL that is independent of blood pressure, but the present data would need to be independently corroborated before such a heart weight QTL can be accepted. Heart weight QTLs independent of blood pressure have been claimed to exist on rat chr 14 (3), chr 17 (24), and chr X (29).
As illustrated in Fig. 1, our QTL localization partially overlaps with the differential segments found in congenic strains constructed by other groups around the Sa gene (4, 16, 26). Our QTL region, however, does not include the Sa gene. Substrains Chr1 x 7 and Chr1 x 15, carrying the Sa gene region, had no effect on blood pressure, suggesting that the Sa gene does not play a role in the S vs. LEW comparison of blood pressure (Fig. 1 and Table 2). This also eliminates the ß and
subunits of the epithelial sodium channel as candidate blood pressure genes in the S vs. LEW comparison because these genes are closely linked to the Sa locus (6, 11, 18). Frantz et al. (4) constructed a congenic substrain, SHR.WKY-Sa, spanning a region similar to our Chr1 x 7 congenic substrain (Fig. 1). Although our Chr1 x 7 congenic strain had no effect on blood pressure, SHR.WKY-Sa had a modest lowering effect on blood pressure. This difference may be due to a number of factors, primarily the rat models used (S/LEW vs. SHR/WKY), diet (salt loading in our case), and age of rats at which blood pressure was taken (10 wk here vs. 16 and 20 wk). Cursory examination of Fig. 2 and Table 3 also suggests that Sa gene expression in SHR is uniquely high, and this might represent an Sa allele in SHR with a unique effect. It will, therefore, be of interest to determine if congenic substrains involving SHR also eliminate the Sa locus as a blood pressure locus.
Introgressing a chromosomal segment harboring the Sa gene obtained from a strain with low Sa gene expression levels onto the genetic background of a hypertensive strain is expected to lower blood pressure as seen in the work done on the congenic strains SHR.WKY-Sa and SHR.BN-D1Mit3/Igf2 (4, 26). Introgressing the high-expressing Sa gene allele onto the background of a normotensive strain increased blood pressure in the WKY.SHR-Sa and WKY.SHR-D1Mit3/Rat57 congenic strains (4, 16). The extent of the congenic segments in these strains is also shown in Fig. 1. The congenic strains used by these groups obviously also contained a large segment of the chromosome around the Sa gene, which must contain a large number of other genes. Thus it cannot be concluded that differential expression of the Sa gene directly results in changes in blood pressure without further substitution mapping using congenic substrains. In our study, the Sa gene was expressed at higher levels in the kidneys of S rats compared with that of the Chr1 x 7 congenic substrain (carrying the LEW Sa allele), where Sa gene expression was essentially not detectable (Fig. 2). Thus the S vs. LEW allelic comparison showed a markedly different expression pattern for the Sa gene, but the blood pressure effect observed by congenic analysis was not significant (Fig. 1 and Table 2). This provided evidence that Sa gene expression is not involved in blood pressure regulation. Our conclusion corroborates the work of Lodwick et al. (21), who showed that there was a major difference in expression of the Sa gene between the Milan hypertensive strain (MHS) and the Milan normotensive strains (MNS) but that the Sa gene in this model did not cosegregate with blood pressure.
| ACKNOWLEDGMENTS |
|---|
Address for reprint requests and other correspondence: J. P. Rapp, Dept. of Physiology and Molecular Medicine, Medical College of Ohio, 3035 Arlington Ave., Toledo, OH 43614-5804 (E-mail: jrapp{at}mco.edu).
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
-, ß-, and
-subunits of epithelial sodium channel in a model of polygenic hypertension. Hypertension 29: 131136, 1997.
1 genes in the Milan hypertensive rat. J. Hypertens. 16: 139144, 1998.
This article has been cited by other articles:
![]() |
P. Y. Woon, P. J. Kaisaki, J. Braganca, M.-T. Bihoreau, J. C. Levy, M. Farrall, and D. Gauguier Aryl hydrocarbon receptor nuclear translocator-like (BMAL1) is associated with susceptibility to hypertension and type 2 diabetes PNAS, September 4, 2007; 104(36): 14412 - 14417. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Garrett, H. Meng, J. P. Rapp, and B. Joe Locating a Blood Pressure Quantitative Trait Locus Within 117 kb on the Rat Genome: Substitution Mapping and Renal Expression Analysis Hypertension, March 1, 2005; 45(3): 451 - 459. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Farjah, T. L. Washington, B. P. Roxas, D. L. Geenen, and R. S. Danziger Dietary NaCl Regulates Renal Aminopeptidase N: Relevance to Hypertension in the Dahl Rat Hypertension, February 1, 2004; 43(2): 282 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Farjah, B. P. Roxas, D. L. Geenen, and R. S. Danziger Dietary Salt Regulates Renal SGK1 Abundance: Relevance to Salt Sensitivity in the Dahl Rat Hypertension, April 1, 2003; 41(4): 874 - 878. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yagil, N. Hubner, R. Kreutz, D. Ganten, and Y. Yagil Congenic strains confirm the presence of salt-sensitivity QTLs on chromosome 1 in the Sabra rat model of hypertension Physiol Genomics, January 15, 2003; 12(2): 85 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Frantz, J.-R. Clemitson, M.-T. Bihoreau, D. Gauguier, and N. J. Samani Genetic Dissection of Region Around the Sa Gene on Rat Chromosome 1: Evidence for Multiple Loci Affecting Blood Pressure Hypertension, August 1, 2001; 38(2): 216 - 221. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. SAAD, M. R. GARRETT, and J. P. RAPP Multiple blood pressure QTL on rat chromosome 1 defined by Dahl rat congenic strains Physiol Genomics, January 19, 2001; 4(3): 201 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. LO, K. L. LIU, J.-R. CLEMITSON, J. SASSARD, and N. J. SAMANI Chromosome 1 blood pressure QTL region influences renal function curve and salt sensitivity in SHR Physiol Genomics, February 11, 2002; 8(1): 15 - 21. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |