|
|
||||||||
Department of Animal Sciences, Purdue University, West Lafayette, Indiana 47906
| ABSTRACT |
|---|
|
|
|---|
gene expression; parturition
| INTRODUCTION |
|---|
|
|
|---|
Approximately equal activities of PEPCK-M and PEPCK-C are present in ruminant liver (13, 31). The activity of PEPCK-C is determined by the rate of transcription of the PEPCK-C gene and rate of turnover of its mRNA (15). The activity of PEPCK-M in liver appears to be constitutive in adult animals (15) but is developmentally regulated in avians (29). Specific induction of PEPCK-M in mammary tissue during the transition to lactation has been noted for guinea pig (19). Previous characterizations of PEPCK mRNA expression in bovine liver (14, 30) have utilized rat PEPCK cDNA probes and have not attempted to differentiate between expression of PEPCK isozymes.
The flux through each PEPCK isozyme and substrate preference for gluconeogenesis may be determined by the availability of NADH in cytosol (13). For example, in avian liver the absence of PEPCK-C and sole presence of PEPCK-M precludes the synthesis of glucose from pyruvate and alanine but not lactate. Metabolism of lactate generates NADH, which is then consumed in the glyceraldehyde-3-phosphate dehydrogenase reaction, whereas alanine and pyruvate metabolism do not generate a matching reducing equivalent.
In ruminants, gluconeogenesis from propionate and presumably pyruvate or alanine may not be limited by cytosolic NADH (1). In mature cows, gluconeogenesis from alanine and propionate are increased during the immediate postpartum interval (25), and increased expression of pyruvate carboxylase during the transition to lactation is consistent with increased potential for alanine metabolism (14). Propionate metabolism is not directly dependent on pyruvate carboxylase, but at least 60% of propionate flux to glucose is dependent on PEPCK-M (1). Increased gluconeogenesis from pyruvate, alanine, or propionate in response to the onset of calving may result from increased channeling of these precursors to glucose but relies on adequate total PEPCK activity to accommodate increased substrate metabolism. Previous analyses of changes in PEPCK mRNA indicate a lack of effect of dietary protein on PEPCK mRNA (14, 16); however, these analyses do not distinguish between the different PEPCK mRNA transcripts. The primary objectives of the present work were to clone the cDNAs for the isozymes of bovine PEPCK, to differentiate expression of their respective mRNA, and determine changes in the abundance of their mRNA transcripts in liver of dairy cows during the transition to lactation.
| METHODS |
|---|
|
|
|---|
Total RNA was reverse transcribed using Superscript II reverse transcriptase (Life Technologies, Grand Island, NY) at 42°C for 1 h. Random hexamers or oligo(dT) were used as primers for first-strand cDNA synthesis. The reverse transcription (RT) reaction product was used in subsequent PCR reactions. Primers (Integrated DNA Technologies, Coralville, IA) corresponding to regions of identity between human (GenBank accession no. L05144), rat (GenBank accession no. AH007109), and mouse (GenBank accession no. AF009605) PEPCK-C were used for PCR cloning of bovine PEPCK-C cDNA. Each primer for RT-PCR and 3' rapid amplification of cDNA ends (RACE) contained a BamHI restriction enzyme site (Table 1). A SalI restriction site was added to the primer for 5'-RACE to facilitate ligation to pGEM 3Z cloning vector (Promega, Madison, WI). Primer pairs used to generate each clone are shown in Table 1.
|
Clone bPEPCK-C4001 was used to design three gene-specific primers (GSP) for use in 5'-RACE to clone the 5' end of bovine PEPCK-C. The GSP I (CATGCTGAACGGGATGACAATAC) annealed to 555576 bases in coding sequence, GSP II (GGAAATCGGATGTTGAATGCTT) annealed to 509530 bases in coding sequence, and GSP III (AAGTCGACCGTATCTCTTTGCTCTCG) annealed to 427446 bases in the coding sequence (Table 1). The GSP I was used in RT reaction to generate first-strand cDNA. Template RNA was digested using RNase H and T1 (Life Technologies). Nucleotides and primers were removed by GlassMAX DNA isolation spin cartridge system (Life Technologies). Subsequent to addition of deoxycytosine (C) residues to the 3' end of the first-strand cDNA by terminal deoxynucleotidyl transferase (Life Technologies), the C-tailed cDNA and primers GSP II and 5'-RACE anchor primer [(CUA)4GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG; Life Technologies] were used for hot start PCR, which was initiated by the addition of C-tailed cDNA at 75°C. The GSP III (Table 1), containing a SalI site and Universal amplification primer CUACUACUACUAGGCCACGCGTCGACTAGTAC (Life Technologies) were used for nested hot start PCR in which cDNA was added to the reaction at 75°C. The PCR conditions, cloning of PCR products and DNA sequencing were as described above.
The 3'-RACE protocol was used for amplification of 3' end of the bovine PEPCK-C cDNA. An oligo(dT) primer with the 5' addition of tandem EcoRI and BamHI sites was used to synthesize the first-strand cDNA. The forward primer (CAGGATCCTTAGCTARAATGCACA) corresponding to the sequence for PEPCK-C from bases 23012326 with an added 5' BamHI site was used for the initial PCR reaction followed by semi-nested PCR using oligo(dT) primer containing the 5' addition of tandem EcoRI and BamHI sites and the nested primer (CAGGATCCAAAASATACTTGAGCTG). The PCR conditions and cloning of PCR products and sequencing were as described above.
The cloning of PEPCK-M cDNA was similar to the 3' end cloning of PEPCK-C. The primers PEPCK-M1 (AAGGATCCTTCCTGTGGCCAGGCT) and the nested primer PEPCK-M2 (AAAGGATCCGTGCTAGACTGGATCTG) were used for semi-nested PCR. These were deduced from regions of similarity for human (NM-004563) and mouse (AA044561) PEPCK-M sequences obtained from GenBank.
Sequence data analysis.
The similarities of the clones to the other PEPCK-C and PEPCK-M cDNA clones were determined at GeneStream II Network Servers for Biology (http://xylian.igh.cnrs.fr/) using Align software (Version 2.0) (26). The Expert Protein Analysis System Translate software at the Swiss Institute of Bioinformatics (http://expasy.cbr.nrc.ca/tools/dna.html) was used to determine the amino acid sequence based on the nucleotide sequence (3). Basic Local Alignment Search Tool (BLAST 2.1) (2) was conducted through the National Center for Biotechnology Information web site (http://www.ncbi.nlm.nih.gov/BLAST).
Northern blot hybridization.
Liver biopsy samples were obtained at -28, -14, +1, +28, and +56 days relative to calving from 10 Holstein cows as described previously (16). Total RNA was extracted from biopsy samples, and 20 µg was separated by electrophoresis through a 1% agarose gel and transferred to GeneScreen membrane (NEN Life Science Products, Boston, MA) and prehybridized as previously described (11).
The cDNA probe for PEPCK-C corresponded to the clone bPEPCK-C3' (Table 1). The cDNA probe for PEPCK-M (bPEPCK-M3') was generated by digestion of bPEPCK-M (Fig. 3) at an internal HindII site, which eliminated a region of similarity between PEPCK-C and PEPCK-M (Fig. 3A). The respective cDNA inserts were excised from plasmids by restriction enzyme digestion and separated by low-melting temperature agarose gel electrophoresis and purified. The 32P-labeled cDNA probes were prepared using [
-32P]dCTP and the Ready-to-Go DNA labeling beads dCTP random oligonucleotide priming kit (Pharmacia) to a specific activity of
109 cpm/µg DNA. Membranes were probed sequentially (11) for PEPCK-C, PEPCK-M, and 18S rRNA (14). Membranes were exposed to Kodak X-Omat film for 13 days at -80°C. The removal of labeled probes from membranes was verified using a Geiger counter and lack of signal upon exposure to Kodak X-Omat film. Abundance of mRNA for each transcript was quantified from digital scans of autoradiographic images using Kodak Digital Science 1D Image Analysis software (Eastman Kodak, Rochester, NY). The size of the transcripts was determined by the migration distance relative to RNA standards using Kodak Digital Science 1D Image Analysis software (Eastman Kodak)
|
Twenty micrograms of total RNA from five cows, collected 28 days prior to and 28 days after calving, was separated through a 1% agarose. Approximately 15 min before the completion of separation, the power supply was switched off, then cRNA standards were added to the wells of the agarose gel, and electrophoresis was resumed. After completion of the separation, nucleotides were transferred to GeneScreen membrane (NEN Life Science Products). The membrane was sequentially hybridized with 32P-labeled bPEPCK-M3' and bPEPCK-C3' probes as described above.
The intensity of binding of the labeled probes to bPEPCK-C3' and bPEPCK-M3' cRNA standards was determined using Kodak Digital Science 1D Image Analysis software (Eastman Kodak). Each set of standards was run in triplicate, and density of signal from the autoradiogram analysis was used to generate prediction equations for PEPCK-C and PEPCK-M mRNA in the samples. Because the lengths of the cRNA standards were considerably shorter than the sample mRNA, the cRNA standards were corrected for the number of deoxycytosine residues in the mRNA relative to the number in cRNA. Bovine PEPCK-C mRNA contains 709 C, and the cRNA standard contains 41 C, therefore a factor of 17.3 (706/41) was used to correct the difference of length between the probe and the mRNA. Because the full-length sequence of bovine PEPCK-M is not known, the adjustment was approximated based on sequence information for human PEPCK-M. Human PEPCK-M mRNA contains 624 C and bPEPCK-M contains 74 C; therefore, a factor of 8.4 (624/74) was used to correct for the length difference of the cRNA standards and sample mRNA. The prediction equations were PEPCK-C (pg) = 11.07 x e0.00007(I) and PEPCK-M (pg) = 2.5899 x e0.00007(I), where I is the intensity of PEPCK mRNA in the sample. The equations for PEPCK-C and PEPCK-M fit the standards data with coefficients of correlation of 0.93 and 0.88, respectively. The membrane was also probed for 18S rRNA, and differences in loading and transfer of RNA among samples were adjusted by normalizing the PEPCK-M and PEPCK-C data to the overall mean intensity of the 18S signal.
Southern blot hybridization.
Genomic DNA from liver was isolated using a genomic DNA isolation kit (Promega, Madison, WI). Bovine genomic DNA (20 µg) was digested separately with 200 U of EcoRI, BamHI, HindIII, and the combination of EcoRI and BamHI for 16 h. Samples were separated through a 0.8% agarose gel at 1.5 V/cm overnight and transferred to GeneScreen membrane (NEN Life Science Products). Membranes were prehybridized for 8 h in 10% dextran sulfate, 1% SDS, and 6x SSC (1x SSC is 0.15 M sodium chloride, 0.015 M sodium citrate, pH 7) and hybridized overnight with bPEPCK-M3' or bPEPCK-C3' cDNA probes. After hybridization, the membranes were washed with 1% SDS and 2x SSC for 15 min at room temperature and 0.1% SDS and 0.1x SSC for 30 min at 65°C and exposed to Kodak X-Omat film for 3 days.
Assay for PEPCK activity.
A subset of samples from cows fed a 14.1% protein diet (16) were used to determine the relationship between PEPCK enzyme activity and PEPCK transcript abundance. Liver biopsy samples (
0.5 g) were rinsed in saline and immediately frozen in liquid nitrogen and stored at -80°C until further analysis of PEPCK activity. Samples were rapidly thawed, blotted dry, and weighed, and crude tissue extracts were prepared by homogenizing in three volumes of ice-cold 0.1 M sucrose, 50 mM potassium phosphate (pH 7.4), and 0.25 mM EDTA (pH 7.4) using a Tissuemizer (Tekmar, Cincinnati, OH). Samples were then sonicated with a probe sonicator (Ultrasonics, Plainview, NY) for 10 s to disrupt mitochondria. The homogenate was kept on ice at all times. Samples obtained from three cows at -28, -14, +1, +28, and +56 days relative to calving were analyzed for PEPCK activity as described by Ballard and Hanson (5) with the addition of NADH and malate dehydrogenase to ensure the conversion of oxaloacetate to malate (4). Reactions and were terminated after 10 min by the addition of 0.25 ml of 10% trichloroacetic acid. Preliminary tests indicated linearity of the assay during this interval. Tubes were centrifuged to remove protein, and an aliquot of the clear supernatant was removed, spotted on a filter paper disk, and placed in an enclosed chamber and purged with CO2 and dried to displace any free 14CO2. Radioactivity remaining in the dried filters was determined by liquid scintillation counting. Protein content of the homogenate was determined using the Pierce BCA protein assay. One unit of PEPCK activity corresponds to the incorporation of 1 µmol of 14CO2 into product per milligram protein per minute.
Statistical analysis.
Data were analyzed as a randomized block design using the GLM procedure of SAS (28). The model accounted for effects of treatment (prepartum dietary protein), cow within treatment, day relative to calving, and treatment by day relative to calving. There were no effects of prepartum diets on PEPCK mRNA; therefore, only the effect of day relative to calving is reported. Effects of day relative to calving and treatment by day relative to calving were analyzed using the residual error as the F-statistic denominator. Values are reported as means with associated standard errors. Means were considered different if P < 0.05. Pearson correlation coefficients were obtained using the PROC CORR procedure of SAS (28).
| RESULTS |
|---|
|
|
|---|
Bovine PEPCK-C and PEPCK-M cDNA and PEPCK-C predicted amino acid sequence.
Bovine PEPCK-C cDNA consists of 2,592 bases including 138 bases of 5'-untranslated region (5'-UTR), 1,866 bases of coding sequence and 588 bases of 3'-UTR (Fig. 1). The complete PEPCK-C sequence is 77% and 75% similar to human and mouse, respectively, and the coding sequence has a minimum of 83% similarity to human, mouse, and rat. The translated sequence encodes a 622 amino acid protein that is 87% similar to human, mouse, and rat (Fig. 2) and contains 13 cysteinyl residues, as well as putative oxaloacetate, GTP, and Mg2+ binding domains characteristic of PEPCK from other species (21).
|
|
Northern blot analysis relationship with total PEPCK activity and abundance of PEPCK isoforms.
Transcripts identified by Northern blotting were
2.85 vs. 2.35 kb for PEPCK-C and PEPCK-M, respectively (Fig. 4). The relative abundance of PEPCK-C mRNA was increased (P < 0.05) moderately by 28 days postcalving but was similar to precalving levels by 56 days postcalving. The abundance of PEPCK-M was unchanged resulting in an increase (P < 0.05) in the ratio of PEPCK-C to PEPCK-M during this interval (Table 2). Quantitative Northern analysis of total RNA samples indicates an abundance of PEPCK-C and PEPCK-M mRNA that was
24.6 ± 17.2 and 1.9 ± 0.2 pg per µg of total RNA (means and SE), respectively, at -28 days relative to calving (Fig. 5). After calving the abundance of PEPCK-C and PEPCK-M mRNA was
59.6 ± 17.2 and 1.8 ± 0.2 pg per µg of total RNA. Although based on a limited number of samples, there was a tendency for PEPCK-C to be elevated (P = 0.18), whereas PEPCK-M was not different for the two sampling times (P = 0.77). Likewise, the ratio of PEPCK-C to PEPCK-M tended to differ (10.9 vs. 35.4; P = 0.14) for samples taken at -28 and +28 days relative to calving. The quantitative data corroborate an increase in PEPCK-C and lack of change in PEPCK-M for the precalving and postcalving comparison. These time points were chosen for quantitative analysis of PEPCK mRNA, because they represent the broadest range in relative expression for most cows based on Northern analysis (Fig. 4). The quantitative data (Fig. 5) should be interpreted with caution, however, due to the limited number of samples analyzed and the variation between individual cows for precalving and postcalving samples. Northern analysis (Fig. 4) provides an estimate of the effect of transition to calving using a greater number of cows (n = 10). The expression of PEPCK-C mRNA, determined by either method, is numerically increased approximately twofold at 28 days postcalving. However, there is considerable variation in the response of individual animals determined by Northern blots analysis such that only 6 of 10 cows display a change in PEPCK-C mRNA on day 28 relative to calving; furthermore, these changes are transient (Fig. 4).
|
|
|
|
4, 20, 1, and 10 kb, for digestion with EcoRI, BamHI, HindIII, and the combination of EcoRI and BamHI, respectively. Bands detected for the bPEPCK-M3' probe were 12, 7, and less than 1 kb for the BamHI-digested genomic DNA. Double digestion with EcoRI and BamHI yielded intense bands at 12 and 8 kb, a minor band less than 5 kb, and two bands less than 1 kb. Single bands of 12 and 8 kb were detected using the shortened form of bPEPCK-M3' as a probe and samples digested with the EcoRI or HindIII, respectively.
|
| DISCUSSION |
|---|
|
|
|---|
Control of PEPCK-C activity is largely exerted through transcription of the gene through activation of basal, tissue-specific, and hormone-dependent promoter elements within the 5' region of the PEPCK-C gene (15). Crucial liver control elements are located within -460 to +73 of the promoter. Six primary protein binding sites that contain docking sites for at least 15 separate transcription factors have been characterized by DNase I footprinting (15). The cAMP response element, CRE-I, acting synergistically with P3 and P4, is primarily responsible for the cAMP-mediated increase in PEPCK-C transcription (15). Insulin counteracts the effects of cAMP by repressing the promoter perhaps by blocking the ability of glucocorticoids to promote activity of accessory factor-2 (24). There is some indication that PEPCK-C expression may be inhibited directly by glucose, as is the case with other insulin-responsive genes. This is intriguing based on the observation that glucokinase is lacking in the ruminant liver (5) but may represent a metabolic advantage considering the continual need for gluconeogenesis in ruminants. Although the PEPCK-C gene is generally thought to be transcriptionally controlled, alternative regulation has been described for PEPCK-C mRNA stability that involves cAMP action on a 3' noncoding sequence (20). It is not surprising that the myriad of hormonal and nutritional changes that accompany the progression of lactation in dairy cows (6) induces the expression of PEPCK-C mRNA. The nutritional and hormonal factors that precipitate changes in PEPCK-C mRNA expression in other species have not been characterized for bovines. Several of these factors are confounded with the homeorhetic adaptations that comprise the onset and progression of lactation. Direct cross-species extrapolation with regard to nutritional and hormonal changes that regulate PEPCK expression must be viewed cautiously, as corresponding data that examine the direct modulation of PEPCK-C are not yet available for cattle.
The relative abundance of PEPCK mRNA isoforms indicates a potential 10-fold difference in the activities of each enzyme in favor of greater activity of PEPCK-C, provided that there is equivalent translation efficiency of both mRNA and similar stability of each enzyme. Available data for relative activities of PEPCK-M and PEPCK-C in ruminants indicates 6676% of PEPCK activity in the cytosol of adult sheep (31), yet in fetal sheep PEPCK-M activity predominates (23). The shifts in the ratio of PEPCK-C to PEPCK-M observed during feed restriction or diabetes in mature sheep (31) and between hypoglycemic, hyperinsulinemic, and normal fetal sheep (23) are the consequence of changes in the activity of the cytosolic form of the enzyme. The present data support an increase in the activity of PEPCK-C in early lactation. These data do not reflect the magnitude of the relationship for activities of PEPCK-C and PEPCK-M activity. Estimates of the translation efficiency of mRNA and stability of the PEPCK enzyme in both cellular compartments are necessary to adequately predict the effects of the transition to lactation on their maximum relative activities.
The PEPCK isozymes have been most extensively characterized for the domesticated chicken (Gallus gallus) (33). The amino acid sequence deduced from corresponding cDNA sequence is 80% identical for the chicken isozymes, whereas comparison of their nucleotide sequences is 60% similar, but the untranslated regions of the two mRNA lack similarity. In chicken, the mitochondrial form contains
1,700 nt of 3' untranslated sequence, whereas the 3' region of the cytosolic form contains 500 nt. Northern blot analysis detects 4.2- and 3.4-kb bands for PEPCK-M in chicken that are easily distinguishable from the 2.8-kb PEPCK-C mRNA. The 4.2- and 3.4-kb PEPCK-M mRNA vary among birds and appear to be the transcription products of polymorphic alleles (29). A single transcript was revealed for bovine PEPCK-M. Northern blot analysis of human liver mRNA reveals the human PEPCK-M to be 2.25 kb and PEPCK-C to be 2.75 kb. Bovine PEPCK mRNA transcripts, determined by Northern blot analysis, were
2.35 ± 0.02 and 2.85 ± 0.07 kb (mean and SD; n = 9 samples) for PEPCK-M and PEPCK-C, respectively. These data and the sequence data for PEPCK-C would suggest the addition of a poly-A tail of
200300 nt. Southern blotting confirms that PEPCK-M and PEPCK-C are products of separate genes.
Although PEPCK-M is usually considered as unregulated and constitutive (17), there is limited evidence to suggest that the activity of PEPCK-M in rabbit liver is specifically reduced with fasting and accompanies a ninefold increase in PEPCK-C activity (22). In ruminants the activity of soluble (cytosolic) and precipitable (mitochondrial) forms of PEPCK lack appreciable responsiveness to dietary and hormonal stimuli (8, 12, 31). Limited data with respect to structural changes in bovine liver that accompany the progression of lactation suggest a decrease in mitochondrial number per cell that is not accompanied by an increase in mitochondrial size (27). Disproportionate changes in the activity of mitochondrial enzymes with altered mitochondrial volume have been noted (9); therefore, it is possible that the activity of PEPCK-M could be maintained during the transition to lactation despite decreased mitochondrial volume. The activities of PEPCK-M and PEPCK-C in guinea pig mammary tissue, per gram of tissue, increased 43- and 10-fold, respectively, by 58 days of lactation, whereas mammary tissue weight increased only 4-fold (19). Although these data point to the potential for specific changes in PEPCK-M, their cause is undetermined. The present data suggest that the capacity for PEPCK-M activity in bovine is not compromised due to a decrease in the abundance of its corresponding mRNA.
The stoichiometry of gluconeogenesis dictates that formation of phosphoenolpyruvate from propionate, pyruvate, and some amino acids requires the independent synthesis of NADH in the cytosol for the subsequent reduction of 1,3-diphosphoglycerate in gluconeogenesis. It has been proposed that PEPCK-C is required for gluconeogenesis from amino acids, and PEPCK-M is more suited to gluconeogenesis from lactate (32). Pyruvate and amino acids are metabolized to oxaloacetate in mitochondria and are shuttled to the cytosol as malate, from which NADH and oxaloacetate are regenerated followed by phosphoenolpyruvate (PEP) formation that is catalyzed by PEPCK-C. Lactate can also be metabolized to PEP in mitochondria of species that possess appreciable PEPCK-M activity (18). Increasing the use of amino acids and propionate for gluconeogenesis may depend on adequate activity of PEPCK-C and independent generation of cytosolic NADH. Reduction in feed intake during the transition to lactation reduces rumen production of propionate, a major gluconeogenic substrate. Lactate recycling to glucose, although critical for supplying glucose for extrahepatic tissues, provides little net increase in glucose entry, whereas amino acids from intestinal absorption and endogenous protein degradation may serve to increase whole body glucose economy. Increasing the supply of glucose carbon by increasing the postruminal supply of amino acids has been suggested as an avenue increasing glucose entry for the periparturient dairy cow (6). The lack of increase in PEPCK-C during the periparturient period in dairy cows coupled with increased gluconeogenesis from alanine and propionate during the immediate postpartum interval (25) suggests that cytosolic NADH and total PEPCK activity do not limit gluconeogenesis from amino acids during this period. The fact that gluconeogenesis from propionate is partially reduced by
40% in the presence of quinolinate, an inhibitor of PEPCK-C, suggests that PEPCK-C is required for maximal glucose synthesis (1). As lactation progresses and the demand for glucose to support lactose synthesis and mammary metabolism increases, a concomitant increase in PEPCK-C expression may be necessary to accommodate increased hepatic propionate supply as a consequence of increased feed intake.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: S. S. Donkin, Dept. of Animal Sciences, 1151 Lilly Hall, Purdue Univ., West Lafayette, IN 47907 (E-mail: sdonkin{at}purdue.edu).
10.1152/physiolgenomics.00108.2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. F. Cooke, J. D. Arthington, D. B. Araujo, G. C. Lamb, and A. D. Ealy Effects of supplementation frequency on performance, reproductive, and metabolic responses of Brahman-crossbred females J Anim Sci, September 1, 2008; 86(9): 2296 - 2309. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Haga, S. Fujimoto, T. Yonezawa, K. Yoshioka, H. Shingu, Y. Kobayashi, T. Takahashi, Y. Otani, K. Katoh, and Y. Obara Changes in Hepatic Key Enzymes of Dairy Calves in Early Weaning Production Systems J Dairy Sci, August 1, 2008; 91(8): 3156 - 3164. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Karcher, M. M. Pickett, G. A. Varga, and S. S. Donkin Effect of dietary carbohydrate and monensin on expression of gluconeogenic enzymes in liver of transition dairy cows J Anim Sci, March 1, 2007; 85(3): 690 - 699. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ferreira and W. P. Weiss Effect of Biotin on Activity and Gene Expression of Biotin-Dependent Carboxylases in the Liver of Dairy Cows J Dairy Sci, March 1, 2007; 90(3): 1460 - 1466. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Drackley, S. S. Donkin, and C. K. Reynolds Major advances in fundamental dairy cattle nutrition. J Dairy Sci, April 1, 2006; 89(4): 1324 - 1336. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Williams, S. M. Rodriguez, D. C. Beitz, and S. S. Donkin Effects of Short-Term Glucagon Administration on Gluconeogenic Enzymes in the Liver of Midlactation Dairy Cows J Dairy Sci, February 1, 2006; 89(2): 693 - 703. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Loor, H. M. Dann, R. E. Everts, R. Oliveira, C. A. Green, N. A. J. Guretzky, S. L. Rodriguez-Zas, H. A. Lewin, and J. K. Drackley Temporal gene expression profiling of liver from periparturient dairy cows reveals complex adaptive mechanisms in hepatic function Physiol Genomics, October 17, 2005; 23(2): 217 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Bradford and M. S. Allen Phlorizin Administration Increases Hepatic Gluconeogenic Enzyme mRNA Abundance but Not Feed Intake in Late-Lactation Dairy Cows J. Nutr., September 1, 2005; 135(9): 2206 - 2211. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Velez and S. S. Donkin Feed Restriction Induces Pyruvate Carboxylase but not Phosphoenolpyruvate Carboxykinase in Dairy Cows J Dairy Sci, August 1, 2005; 88(8): 2938 - 2948. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Hammon, C. Philipona, Y. Zbinden, J. W. Blum, and S. S. Donkin Effects of Dexamethasone and Growth Hormone Treatment on Hepatic Gluconeogenic Enzymes in Calves J Dairy Sci, June 1, 2005; 88(6): 2107 - 2116. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Velez and S. S. Donkin Bovine Somatotropin Increases Hepatic Phosphoenolpyruvate Carboxykinase mRNA in Lactating Dairy Cows J Dairy Sci, May 1, 2004; 87(5): 1325 - 1335. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Hammon, S. N. Sauter, M. Reist, Y. Zbinden, C. Philipona, C. Morel, and J. W. Blum Dexamethasone and colostrum feeding affect hepatic gluconeogenic enzymes differently in neonatal calves J Anim Sci, December 1, 2003; 81(12): 3095 - 3106. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||