Physiol. Genomics Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Physiol. Genomics 19: 143-150, 2004. First published August 10, 2004; doi:10.1152/physiolgenomics.00046.2004
1094-8341/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
19/1/143    most recent
00046.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Konstantinov, I. E.
Right arrow Articles by Redington, A. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konstantinov, I. E.
Right arrow Articles by Redington, A. N.
Received 20 February 2004; accepted in final form 15 July 2004.
Physiological Genomics 19:143-150 (2004)
1094-8341/04 $5.00 © 2004 American Physiological Society

The remote ischemic preconditioning stimulus modifies inflammatory gene expression in humans

Igor E. Konstantinov1,*, Sara Arab2,*, Rajesh K. Kharbanda3, Jia Li4, Michael M. H. Cheung4, Vera Cherepanov5, Gregory P. Downey5, Peter P. Liu2, Eva Cukerman2, John G. Coles1 and Andrew N. Redington4

1 Division of Cardiovascular Surgery, Hospital for Sick Children, University of Toronto, Toronto, Canada
2 Division of Cardiology, Heart, and Stroke Richard Lewar Centre of Excellence, University of Toronto, Toronto, Canada
3 University of Cambridge, Addenbrooke’s Centre for Clinical Investigation, Cambridge, United Kingdom
4 Division of Cardiology, Hospital for Sick Children, University of Toronto, Toronto, Canada
5 Division of Respirology, Toronto General Hospital, University of Toronto, Toronto, Canada


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 References
 
Remote ischemic preconditioning (IPC) reduces tissue injury caused by ischemia-reperfusion (IR) in distant organs. We tested the hypothesis that remote IPC (rIPC) modifies inflammatory gene transcription in humans. Using a microarray method, we demonstrated that a simple model of brief forearm ischemia suppresses proinflammatory gene expression in circulating leukocytes. Genes encoding key proteins involved in cytokine synthesis, leukocyte chemotaxis, adhesion and migration, exocytosis, innate immunity signaling pathways, and apoptosis were all suppressed within 15 min (early phase IPC) and more so after 24 h (second window IPC). Changes in leukocyte CD11b expression measured by flow cytometry mirrored this pattern, with there being a significant (P = 0.01) reduction at 24 h. The results of this study show that the rIPC stimulus modifies leukocyte inflammatory gene expression. This effect may contribute to the protective effect of IPC against IR injury and may have broader implications in other inflammatory processes. This is the first study of human gene expression following rIPC stimulus. rIPC stimulus suppressed proinflammatory gene transcription in human leukocytes.

genes; inflammation; ischemia; leukocytes; reperfusion


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 References
 
ISCHEMIA-REPERFUSION (IR) injury is a ubiquitous insult in the broad spectrum of cardiovascular disease. Although cerebrovascular ischemia and myocardial infarction resulting from arterial occlusion are characterized by metabolic dysfunction, apoptosis, and necrosis, there often exists an equally destructive reperfusion injury that involves local inflammatory processes requiring leukocyte trafficking, stimulation, and exocytosis of proinflammatory chemokines. However, antileukocyte strategies have proven disappointing in the reduction of clinically important IR injury, possibly reflecting multiple signaling pathways involved in this process.

Ischemic preconditioning (IPC) is the most powerful innate mechanism to protect against IR injury. Observed across many mammalian species, including humans, IPC involves a brief period of sublethal local tissue ischemia that confers protection against a subsequent lethal ischemia. The early phase of IPC, referred to as "classic" preconditioning, is observed immediately after brief ischemia and is sustained for ~3 h. A delayed phase ("second window") of preconditioning has been demonstrated at 18–24 h following brief ischemia (25).

A more intriguing form of IPC with potentially greater clinical significance is "remote" IPC (rIPC). Transient tissue ischemia at a distance may confer subsequent protection of organ subjected to potentially lethal ischemia. The magnitude of its protection approaches that of local IPC, certainly in the context of myocardial infarction. Indeed, our own data demonstrated a 50% reduction in myocardial infarction in a porcine model of rIPC (17).

Given the central role of leukocytes in the pathogenesis of IR injury and the resulting systemic inflammatory response syndrome (SIRS), it would be surprising if modulation of their activity was not integral to the preconditioning effect. However, relatively little is known about the influence of preconditioning stimuli on regulation of leukocyte function. In one experimental study remote preconditioning by hindlimb ischemia reduced lung neutrophil sequestration in response to a systemic inflammatory syndrome (13). Furthermore, we have recently demonstrated that transient forearm ischemia affords protection against endothelial IR injury and suppresses circulating neutrophil activity in humans (18).

Although there is substantial evidence to suggest that the mechanisms of IPC converge on the mitochondrial ATP-sensitive potassium (K-ATP) channel, it is becoming apparent that IPC also involves changes in gene expression (8). However, there are currently no data regarding potential genomic mechanisms in rIPC. In this study we examined the effects of the stimulus of human forearm ischemia that we have used to induce local and rIPC in humans on early and late gene regulation and transcription in leukocytes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 References
 
Subjects and Blood Samples
The study was performed on four healthy adult volunteers (3 males, 1 female), who were taking no medication (mean age, 37 yr). The rIPC protocol was as previously described (18). Briefly, the forearm was made ischemic by inflating a blood pressure cuff to 200 mmHg for three 5-min periods, separated by 5 min of reperfusion. Venous blood was drawn from the contralateral arm prior to ischemic stimulus, 15 min after completion, and 24 h later. Thus 12 samples were collected in standard sterile tripotassium-EDTA tubes (Vacutainer; Preanalytical Solutions, Franklin Lakes, NJ) and transported on ice for immediate RNA isolation. The experimental design was approved by the Hospital for Sick Children Research Ethics Board (file number 1000000626 of November 11, 2002). The experimental design, gene lists, hierarchical trees, microarray hybridization, and statistical analysis were performed in compliance with the "minimum information about a microarray experiment" (MIAME) guidelines (3).

RNA Isolation
Total RNA (TRNA) was isolated from 12 blood samples utilizing TRIzol Reagent (GIBCO-BRL) following the manufacturer’s protocol. The quality of TRNA was assessed by Agilent 2100 Bioanalyzer (version A.02.01S1232, Agilent Technologies). Only RNA with the OD ratio of 1.99–2.0 at 260/280 was used.

Affymetrix GeneChip Hybridization and Staining
A total of 13 hybridizations were performed on the human HG-U133A GeneChip Set (Affymetrix, Santa Clara, CA) with the 12 TRNAs from blood samples of 4 individuals at 3 different time points (control, 15 min after rIPC, 24 h after rIPC) and 1 reference TRNA (Stratagene) as a universal control. Samples were prepared for hybridization according to standard Affymetrix instructions and performed at the genomic core center at the Hospital for Sick Children. Briefly, a primer encoding the T7 RNA polymerase promoter linked to oligo-dT17 was used to prime double-stranded cDNA synthesis from each mRNA sample using SuperScript II RNase H reverse transcriptase (Life Technologies, Rockville, MD). Each purified (QiaQuick kit, Qiagen) double-stranded cDNA was in vitro transcribed using T7 RNA polymerase (T7 kit; Enzo Biochemicals, New York, NY), incorporating biotin-UTP (Enzo) into the cRNAs, followed by purification using RNeasy (Qiagen) and quantitated by measuring absorption at 260 nm/280 nm. Samples were fragmented and hybridized to the GeneChip for 16 h at 45°C and scanned (GeneArray scanner, Affymetrix). MicroArray Suite version 5.0 (MAS 5.0; Affymetrix) was used to scale intensities across the GeneChips to 150 fluorescence units and to determine expression values for each gene on the GeneChip. The expression value for each gene was determined by calculating the average of differences (perfect match intensity minus mismatch intensity) of the probe pairs in use for the gene.

Affymetrix GeneChip Data Analysis
Gene analysis software.
Data analysis was performed using two independent software packages, GeneChip (Affymetrix) and GeneSpring (Silicon Genetics, Redwood, CA).

Data analysis.
Scanned raw data were processed with Affymetrix MAS 5.0 software. The average intensity value for each probe set, which directly correlates with mRNA abundance, was calculated as an average of fluorescence differences for each perfectly matched vs. single-nucleotide mismatched probe. To test the integrity of the starting RNA, we examined the signal intensity ratio for the 3' probe set over the 5' probe set for the housekeeping genes ß-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). For the 13 arrays used in this study, the 3'-to-5' ratios were 1.3 ± 0.07 and 0.97 ± 0.06 for ß-actin and GAPDH, respectively. Once sample quality was demonstrated, those genes with consistently present calls were considered. To monitor the expression of chosen genes over the different experimental time points, data obtained from MAS 5.0 absolute analyses of all the individual arrays were analyzed and clustered using GeneSpring (http://www.silicongenetics.com).

GeneSpring 6.1 was then used for normalization, each sample was normalized to its control (untreated), and then genes were filtered first based on P < 0.05; then one-way ANOVA (not equal variance) was performed on these genes, and, finally, 1.5-fold up- or downregulated genes in 24 h vs. control generated 169 genes that were used for hierarchical clustering (Fig. 1). Each sample was analyzed individually, and none of the methods was applied to pooled data.



View larger version (90K):
[in this window]
[in a new window]
 
Fig. 1. Hierarchical clustering of differentially expressed genes before and after the remote ischemic preconditioning (rIPC). Data filtering and two-way hierarchical cluster analysis identify 169 genes that were differentially expressed before and after rIPC. Gene expression levels are depicted as color variation from red (high expression) to blue (low expression). The color in each cell of the figure displays the level of expression for each gene (columns) in blood of each individual subject (row).

 
Microarray Validation
Validation of the microarray method was performed using reverse transcription polymerase chain reaction (RT-PCR). It was performed on TRNA isolated from blood in each of four individuals for one of the upregulated genes, calpastatin. The experiments were performed in duplicates. PCR results for calpastatin expression demonstrated the trend identical to microarray results. Expression profile of calpastatin in all samples were confirmed using one-step RT-PCR (Qiagen). Primer sequences were designed using GeneRunner program directed toward the 3' sequence of the gene. The primers sequences for calpastatin was as follows: forward, TTGATTTCTCTGATGGCTGCTG; reverse, GTGAATCGCCTTCCAAACCAGG. The GAPDH was used as an internal control for every PT-PCR for each individual sample.

Assessment of Neutrophil Activation
Neutrophil activation was accessed by the level of expression of CD11b ({alpha}-chain of the integrin adhesion molecule CD11b/CD18, Mac-1) and measured by fluorescence intensity of FITC-conjugated IgG1 monoclonal antibody directed against CD11b (Serotec), expressed as the median fluorescence intensity (MFI) of the total leukocyte population. Samples were analyzed by flow cytometry within 1 h of collection as previously described (18).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 References
 
Effects on Gene Expression
RNA isolated from blood was analyzed on oligonucleotide arrays representing over 50% of the estimated total number of human genes (Affymetrix, http://www.affymetrix.com). Data filtering (P < 0.05) and hierarchical clustering (using an average linkage algorithm: GeneSpring software, Silicon Genetics) identified significant changes in the expression of ~169 genes over the course of the study period (Fig. 1).

The expression of some genes varied among individuals, particularly at the initial stage of the response (15 min); however, the majority of differentially expressed genes depicted identical patterns at 24 h. Our complete microarray data and analysis algorithm are available on the CHFNET Group web site (http://www.chfnet.ca/supplementkonst.asp).

The expression of 35 genes was upregulated at both 15 min and 24 h after forearm ischemia, while the expression of 134 genes was suppressed. The key genes involved in innate immune responses, TNF-signaling pathways, leukocyte adhesion, chemotaxis, and exocytosis are listed in Table 1. Of particular interest to the potential anti-inflammatory influence of the genomic responses observed was the upregulation of heat shock protein (HSP) 70 and calpastatin, as well as the downregulation of genes of innate immunity responses (TLR4) and TNF signaling pathway (TNFR6). Genes encoding proteins crucial to intracellular proinflammatory mechanisms, e.g., programmed cell death (caspase-8), leukocyte extravasation (PI3KCA), and secretory granule release (SNP-23) were also significantly downregulated.


View this table:
[in this window]
[in a new window]
 
Table 1. Transcription of the key genes of inflammatory response

 
Effects on CD11b Expression
At baseline, the MFI for CD11b expression was 17.0 ± 5.2 U. After 15 min of reperfusion CD11b expression decreased to 11.5 ± 4.7 U but did not reach statistical significance (P = 0.23). It decreased further at 24 h to 5.3 ± 0.9 U, and the difference was significant compared with baseline (P = 0.01).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 References
 
Our data demonstrate for the first time that the rIPC stimulus achieved by transient forearm ischemia has predominantly downregulatory effects on gene expression in circulating human leukocytes. The magnitude of change associated with our in vivo human experiments approaches that reported, using identical microarray techniques, in ex vivo neutrophil (8) and eosinophil (41) preparations subjected to supraphysiological stimuli. Approximately 30 key genes known to be involved in leukocyte activation and innate immunity, cell adhesion, intracellular signaling, and effector pathways such as exocytosis were affected.

HSP70 Transcription and TLR Pathway Genes
Expression of HSP70 was upregulated at 15 min and more markedly at 24 h (Table 1 and Fig. 2). HSP70 activates NF-{kappa}B via toll-like receptor (TLR) stimulation, utilizing its toll/IL-1R/plan R gene homology (TIR) domain, myeloid differentiation protein (MyD88), interleukin (IL)-1 receptor-associated kinase (IRAK), TNF receptor-associated family (TRAF), and I{kappa}B kinases (IKK)(41) (Table 1 and Fig. 2). It is of interest that both HSP70 and bacterial lipopolysaccharide (LPS) transduce the signal through a glycosylphosphatidylinositol-anchored membrane protein, CD14 receptor (Figs. 2 and 3). CD14 associated with the cell surface by means of a glycolipid linkage and is not capable of generating a transmembrane signal. It is likely that the HSP70 or LPS attach to LPS binding protein (LBP)-CD14 complex and activate TLR4, which in turn, via its TIR domain, signals through the adapter protein MyD88 and the serine kinase, IRAK. MD-2, a secreted protein that binds to the extracellular domain of TLR4 as well as multiple leucine-rich repeats of both TLR4 and CD14, might facilitate protein-protein reaction and are important in the signaling (1, 41). Neither MyD88 or IRAK genes were suppressed in our study. HSP70 also has an important intracellular cytoprotective role against the wide variety of inflammatory stimuli (4). Our finding of suppression of the key genes involved in TNF-{alpha} synthesis (see below) is consistent with the observations that prior exposure to either LPS (43) or HSP70 (21, 45) decreases subsequent TNF-{alpha} production. TLR4 is involved in LPS-induced oxidative burst in neutrophils and has a role in IR injury (31, 35). We observed significant downregulation of the TLR4 gene at both 15 min and 24 h (Table 1).



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 2. Innate immunity pathways. Red indicates upregulated genes, yellow indicates gene expression was not changed, and green indicates downregulated genes. HSP, heat shock protein; LPS, lipopolysaccharide; LBP, LPS binding protein; TLR, toll-like receptor; IRAK, interleukin (IL)-1 receptor associated kinase; TIR, toll/IL-1/plan R homology domain; TNF, tumor necrosis factor; TRAF, TNF receptor-associated family; TRADD, TNF receptor-associated death domain; IKK, I-{kappa}B kinase; and MnSOD, manganese superoxide dismutase. For further detailed definitions of abbreviations, refer to the main text and Table 1.

 


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 3. Leukocyte chemotaxis and adhesion genes. Red indicates upregulated genes, yellow indicates gene expression was not changed, and green indicates downregulated genes. NO, nitric oxide; PECAM, platelet-endothelial cell adhesion molecule; CD18, ß2-integrin; ADAM, a disintegrin and metalloprotease; CKR2a, chemokine C-C motif receptor 2; TCR, T-cell receptor; TM7LN4, G protein-coupled receptor; MEKK, mitogen activated protein kinase (MAP)/extracellular-signal-regulated kinase (ERK) kinase (MEK) kinase. For further detailed definitions of abbreviations, refer to the legend of Fig. 2, the main text, and Table 1.

 
TNF-{alpha} Signaling Pathway
TNF-{alpha} plays a key role in postischemic damage in various organs including the brain, heart, liver, and lung. TNF pretreatment results in reduction of IR injury and correlates with an increase in myocardial antioxidant, manganese superoxide dismutase (MnSOD) activity (29, 49). MnSOD is also induced by TNF-{alpha}, IL-1, LPS, and HSP70 (Fig. 2). TNF also plays an important role in late IPC (7, 49) by activation of the NF-{kappa}B, which in turn upregulates MnSOD synthesis (48). Although both TNF and MnSOD may be induced via the CD14 and TLR4 receptors (43), cells have a specific TNF receptor (TNF-R1) through which TNF induces NF-{kappa}B-dependent MnSOD synthesis (Fig. 2). We observed suppression of TNF receptor superfamily, member 6 (TNFR6), but there was no suppression of TNF-R1. It has been suggested that preconditioning activates TNF, which has a negative autoregulatory effect attenuating the subsequent production of proinflammatory cytokines during IR. This hypothesis is consistent with the findings of a recent murine study showing that low-dose TNF-{alpha} protects against hepatic IR injury (42). In other studies TNF was also shown to confer cytoprotection via induction of MnSOD (47) and to induce tolerance to myocardial ischemia in a rodent model (7, 49). The suppression of NF-{kappa}B p65 subunit (NFKB3) observed in our study (Fig. 2) is of special interest because of recent reports identifying it as a potential site of uncoupling of TNF-{alpha}-induced production of cytokines and MnSOD. NFKB3 is also indispensable for MnSOD activation (24) and TNF synthesis (10). Thus initial TNF signaling pathway activation by IPC induces protective MnSOD synthesis, but yet suppresses gene expression responsible for subsequent TNF synthesis and TNF signaling pathway restoration. This is consistent with prior observations that general nonspecific inhibition of transcription abolishes protective effect of IPC (39).

The reduction in transforming growth factor-ß-activated kinase 1 (TAK1) is important in I{kappa}B kinase-mediated activation of the NF-{kappa}B pathway (40). TNF-{alpha}-induced activation of the NF-{kappa}B is associated with binding of TAK1 to TRAF, and both IKK{alpha} and IKKß and thus play a role in TNF-{alpha} signaling (Fig. 2). TAK1-binding protein (TAB2) acts as an adapter linking TAK1 to TRAF. Both TAK1 and TAB2 gene expression was suppressed (Table 1).

TNF Synthesis
All three key kinases involved in TNF synthesis, MAPKAPK2, MEKK2, and MAP3K8, were suppressed (Table 1). It is established that the mitogen-activated protein kinase (MAPK) p38 regulates cytokines, including TNF-{alpha} production at the translational level, and the effect of MAPK p38 is mediated by mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2) (19). Indeed, elimination of MAPKAPK2 in a mouse knockout model results in significantly decreased MAPK p38 levels in most tissues, but especially in heart and liver, and reduced synthesis of TNF-{alpha} protein (20). TNF production was restored by adding catalytically active MAPKAPK2, but not MAPKA p38 alone (20). In addition, MAP/ERK kinase (MEK) kinase (MEKK) 2 activation is critical for c-Jun-N-terminal kinase (JNK) activation and TNF-{alpha} production (5).

Apoptosis
IR injury initiates caspase-8-mediated apoptosis (30). Caspase-8 induction is mediated by TNF via TNF-R1 and Fas-associated death domain (FADD) (Fig. 2). Activated neutrophils and macrophages stimulate Fas via production of reactive oxygen species (30). In our study there was a marked reduction of caspase-8 and caspase-8-associated protein 2 (CASP8AP2) gene expression within 15 min of transient forearm ischemia, which persisted at 24 h (Table 1). CASP8AP2 plays a regulatory role in Fas-mediated apoptosis (6).

Exocytosis
Soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptors (SNAREs) are core machinery for membrane fusion during exocytosis (Fig. 2) in many cells, including mast cells and human neutrophils (11, 28). A synaptosome-associated protein (SNAP-23) is a target SNARE (t-SNARE) with crucial involvement in mast cell and neutrophil exocytosis (11, 26, 28). We observed a threefold reduction in SNAP-23 gene expression at 24 h following forearm ischemia (Table 1). Expression of the genes encoding other exocytosis-related SNAREs [syntaxin 3, vesicle-associated membrane protein 3 (VAMP3 or cellubrevin)] and coated vesicle membrane protein (P24A) was also significantly suppressed (P < 0.005) (Table 1). Relocation of SNAP-23 from cell surface to the secretory granules membrane is prerequisite for exocytosis (11). As secretory granules in unstimulated mast cells lack SNAP-23, formation of ternary SNARE complexes with syntaxin 3 and VAMP relative is not possible until SNAP-23 relocates (Fig. 2). This implies that relocation of SNAP-23 controls entry of mast cell granules into the "fusion-ready" state (11).

Expression of CD11b
This study was designed primarily to examine potential changes in gene expression imposed by this stimulus. The functional implications of these genetic changes need to be examined systematically. However, CD11b receptor is expressed on the surface of activated leukocytes by exocytosis (Fig. 2). We have previously shown, in a model of local preconditioning, that a similar IPC stimulus reduces early CD11b expression (18).

Chemotaxis, Cell Adherence, and Extravascular Cell Migration
Chemokines attract circulating leukocytes to the microvasculature by triggering inside-out signal transduction pathways leading to integrin-dependent adhesion (43) (Fig. 3). Integrin activation by chemokines is very rapid and allows binding of rolling cells to the endothelium within minutes (23, 43). Chemokine activity may be mediated through activation of the G protein-coupled receptor TM7LN4, the expression of which was reduced in our study (15). (Table 1). Similarly, there was a significant suppression of gene expression of lymphocyte cytosolic protein 2 (SLP-76), an important adaptor of T-cell receptor (TCR) that plays a central role in normal T-cell and mast cells activation (44). It is of interest that {alpha}4-integrin (Fig. 3) functions not only as an adhesion molecule, but also mediates neutrophil free radical injury to cardiac myocytes (32, 33). Addition of an anti-{alpha}4-integrin antibody completely inhibited oxidant production, even though neutrophils continue to adhere to the myocyte via ß2-integrins (CD18) (32). Neutrophil migration across mouse cardiac endothelium persists in the absence of CD18 but is completely blocked by antibodies against {alpha}4-integrin or VCAM-1 (2). We showed suppression of the gene for {alpha}4-integrin (CD49D) by twofold in 24 h (Table 1).

Chemokine CC receptor 2 (CKR2a) plays a central role in neutrophil and macrophage migration (22, 27) and respiratory burst in human neutrophils (33). Profound reduction in leukocyte adhesion with severely decreased monocyte and neutrophil extravasation was observed in mice deficient in CKR2a (22, 27), which was also suppressed by forearm ischemia in our study (Table 1 and Fig. 3). The phosphoinositide 3-kinase (PI3K) catalytic subunit p110 (PI3KCA)-{delta} is expressed in neutrophils and facilitates their accumulation at sites of inflammation by contributing to chemoattractant-directed migration. The blockade or gene deletion of PI3KCA reduces neutrophil influx into tissues by diminishing their attachment to and migration across endothelium (34). We observed significant suppression of PI3KCA gene expression (Table 1).

Calpain regulates ß1 ({alpha}4)-integrin-mediated leukocyte adhesion (9, 36). Leukocyte {alpha}4-integrin, and its endothelial ligand vascular cell adhesion molecule (VCAM)-1, are crucial in neutrophil migration across endothelium (2). Selective inhibition of calpain attenuates neutrophil-mediated myocardial IR injury (14). We observed late upregulation of the endogenous calpain inhibitor, calpastatin (CAST), which was only significant at 24 h (Table 1). Gene expression of platelet endothelial cell adhesion molecule (PECAM1, CD31) was suppressed (Table 1). We have recently observed a significant reduction in blood level of troponin I (TnI) in animal model by rIPC after cardiopulmonary bypass (CPB) (16). Because calpain degrades TnI, activation of calpastatin gene expression is consistent with preservation of TnI by rIPC (16) or glucocorticoids (38). PECAM1 is expressed on endothelial cells, leukocytes, and platelets. Blockade of PECAM1 reduces IR injury via inhibition of neutrophil migration (12). Finally, gene expression of ADAM 8 and 10, both leukocyte adhesion molecules, and MAPKAPK2, inhibition of which reduces filopodium formation and migration of macrophages (20), was suppressed (Table 1).

Tissue Inhibitor of Matrix Metalloproteinase (TIMP)
TIMP-1 inhibits matrix metalloproteinases (MMP) 2 and 9, both of which play a crucial role in acute myocardial dysfunction after IR injury (37, 46). TIMP-1 is also known to inhibit proteases of the ADAM ("a disintegrin and metalloprotease") family, including ADAM 10. TIMP gene expression was upregulated in the present study, whereas ADAM 8 and 10 genes were suppressed (Table 1).

Although the proteomic and functional implications of these findings are yet to be fully elaborated, it is clear from many other studies that leukocytes play a central role in IR injury. We have previously shown increased neutrophil CD11b expression and platelet-neutrophil complex formation in response to 20 min of forearm ischemia, which was attenuated by IPC (18). Furthermore, in an experimental model of SIRS, remote preconditioning by transient limb ischemia significantly reduced pulmonary neutrophil infiltration and other markers of acute lung injury (13). IPC appears to also modify leukocyte gene transcription in these models.

In summary, the concept of protection remote from the original ischemic stimulus widens the potential applicability of IPC in the clinical setting. Although the mechanisms of distant protection against IR injury are not completely understood, these may include a potent and broad-spectrum suppression of inflammatory signals. By implication, it is intriguing to speculate that modification of white cell responses using this stimulus may have more diverse applications in human disease.


    GRANTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 References
 
R. K. Kharbanda is supported by the British Heart Foundation. M. M. H. Cheung is supported by Heart and Stroke Foundation of Ontario. This study was partially funded by the Canadian Institutes for Health Research and the Canadian Heart Failure Network Interdisciplinary Health Research Team (CHFNET IHRT) program grants.


    ACKNOWLEDGMENTS
 
We are grateful to Dr. Bruce Aronow for critical review of the manuscript and insightful suggestions that enhanced the interpretation and presentation of our data.


    FOOTNOTES
 
* I. E. Konstantinov and S. Arab contributed equally to this work. Back

Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: A. N. Redington, Division of Cardiology, The Hospital for Sick Children, 555 Univ. Ave., Toronto, ON, Canada M5G 1X8 (E-mail: andrew.redington{at}sickkids.ca).


    References
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 References
 

  1. Asea A, Rehli M, Kabingu E, Bare O, Auron PE, Stevenson MA, and Calderwood SK. Novel signal transduction pathway utilized by extracellular HSP70: role of toll-like receptor (TLR) 2 and TLR4. J Biol Chem 277: 15028–15034, 2002.[Abstract/Free Full Text]
  2. Bowden RA, Ding ZM, Donnachie EM, Petersen TK, Michael LH, Ballantyne CM, and Burns AR. Role of {alpha}4 integrin and VCAM-1 in CD18-independent neutrophil migration across mouse cardiac endothelium. Circ Res 90: 562–569, 2002.[Abstract/Free Full Text]
  3. Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, Aach J, Ansorge W, Ball CA, Causton HC, Gaasterland T, Glenisson P, Holstege FC, Kim IF, Markowitz V, Matese JC, Parkinson H, Robinson A, Sarkans U, Schulze-Kremer S, Stewart J, Taylor R, Vilo J, and Vingron M. Minimum information about a microarray experiment (MIAME): toward standards for microarray data. Nat Genet 29: 365–371, 2001.[CrossRef][ISI][Medline]
  4. Bruemmer-Smith S, Stuber F, and Schroeder S. Protective function of intracellular heat-shock protein (HSP) 70-expression in patients with severe sepsis. Intensive Care Med 27: 1835–1841, 2001.[CrossRef][Medline]
  5. Chayama K, Papst PJ, Garrington TP, Pratt JC, Ishizuka T, Webb S, Ganiatsas S, Zon LI, Sun W, Johnson GL, and Gelfand EW. Role of MEKK2-MEK5 in the regulation of TNF-alpha gene expression and MEKK2-MKK7 in the activation of c-Jun N-terminal kinase in mast cells. Proc Natl Acad Sci USA 98: 4599–4604, 2001.[Abstract/Free Full Text]
  6. Choi YH, Kim KB, Kim HH, Hong GS, Kwon YK, Chung CW, Park YM, Shen ZJ, Kim BJ, Lee SY, and Jung YK. FLASH coordinates NF-kB activity via TRAF2. J Biol Chem 276: 25073–25077, 2001.[Abstract/Free Full Text]
  7. Eddy LJ, Goeddel DV, and Wong GH. Tumor necrosis factor-alpha pretreatment is protective in a rat model of myocardial ischemia-reperfusion injury. Biochem Biophys Res Commun 184: 1056–1059, 1992.[CrossRef][ISI][Medline]
  8. Fessler MB, Malcolm KC, Duncan MW, and Worthen GS. A genomic and proteomic analysis of activation of the human neutrophil by lipopolysaccharide and its mediation by p38 mitogen-activated protein kinase. J Biol Chem 277: 31291–31302, 2002.[Abstract/Free Full Text]
  9. Forsythe P and Befus AD. Inhibition of calpain is a component of nitric oxide-induced down-regulation of human mast cell adhesion. J Immunol 170: 287–293, 2003.[Abstract/Free Full Text]
  10. Ginis I, Jaiswal R, Klimanis D, Liu J, Greenspon J, and Hallenbeck JM. TNF-alpha-induced tolerance to ischemic injury involves differential control of NF-kB transactivation: the role of NF-kB association with p300 adaptor. J Cereb Blood Flow Metab 22: 142–152, 2002.[CrossRef][ISI][Medline]
  11. Gou Z, Turner C, and Castle D. Relocation of the t-SNARE SNAP-23 from lamellipodia-like cell surface projections regulates compound exocytosis in mast cells. Cell 94: 537–548, 1998.[CrossRef][ISI][Medline]
  12. Gumina RJ, el Schultz J, Yao Z, Kenney D, Warltier DC, Newman PJ, and Gross GJ. Antibody to platelet/endothelial cell adhesion molecule-1 reduces myocardial infarct size in a rat model of ischemia-reperfusion injury. Circulation 94: 3327–3333, 1996.[Abstract/Free Full Text]
  13. Harkin DW, Barros D’Sa AA, McCallion K, Hoper M, and Campbell FC. Ischemic preconditioning before lower limb ischemia-reperfusion protects against acute lung injury. J Vasc Surg 35: 1264–1273, 2002.[CrossRef][Medline]
  14. Ikeda Y, Young LH, and Lefer AM. Attenuation of neutrophil-mediated myocardial ischemia-reperfusion injury by a calpain inhibitor. Am J Physiol Heart Circ Physiol 282: H1421–H1426, 2002.[Abstract/Free Full Text]
  15. Keane MP and Strieter RM. Chemokine signaling in inflammation. Crit Care Med 28: N13–N26, 2000.[CrossRef][ISI][Medline]
  16. Kharbanda RK, Li J, Konstantinov IE, Cheung MM, White PA, Stokoe J, Cox P, Vogel M, Van Arsdell GS, MacAllister R, and Redington AN. Remote ischemic preconditioning protects from cardiopulmonary bypass injury in vivo (Abstract). Circulation 108: IV-509–IV-510, 2003.
  17. Kharbanda RK, Mortensen UM, White PA, Kristiansen SB, Schmidt MR, Hoschtitzky JA, Vogel M, Sorensen K, Redington AN, and MacAllister R. Transient limb ischemia induces remote ischemic preconditioning in vivo. Circulation 106: 2881–2883, 2002.[Abstract/Free Full Text]
  18. Kharbanda RK, Peters M, Walton B, Kattenhorn M, Mullen M, Klein N, Vallance P, Deanfield J, and MacAllister R. Ischemic preconditioning prevents endothelial injury and systemic neutrophil activation during ischemia-reperfusion in humans in vivo. Circulation 103: 1624–1630, 2001.[Abstract/Free Full Text]
  19. Kotlyarov A, Neininger A, Schubert C, Eckert R, Birchmeier C, Volk HD, and Gaestel M. MAPKAP kinase 2 is essential for LPS-induced TNF-alpha biosynthesis. Nat Cell Biol 1: 94–97, 1999.[CrossRef][ISI][Medline]
  20. Kotlyarov A, Yannoni Y, Fritz S, Laass K, Telliez JB, Pitman D, Lin LL, and Gaestel M. Distinct cellular functions of MK2. Mol Cell Biol 22: 4827–4835, 2002.[Abstract/Free Full Text]
  21. Kume M, Yamamoto Y, Saad S, Gomi T, Kimoto S, Shimabukuro T, Yagi T, Nakagami M, Takada Y, Morimoto T, and Yamaoka Y. Ischemic preconditioning of the liver in rats: implications of heat shock protein induction to increase tolerance of ischemic-reperfusion injury. J Lab Clin Med 128: 251–258, 1996.[CrossRef][ISI][Medline]
  22. Kuziel WA, Morgan SJ, Dawson TC, Griffin S, Smithies O, Ley K, and Maeda N. Severe reduction in leukocyte adhesion and monocyte extravasation in mice deficient in CC chemokine receptor 2. Proc Natl Acad Sci USA 94: 12053–12058, 1997.[Abstract/Free Full Text]
  23. Laudanna C, Kim JY, Constantin G, and Butcher E. Rapid leukocyte integrin activation by chemokines. Immunol Rev 186: 37–46, 2002.[CrossRef][ISI][Medline]
  24. Maehara K, Hasegawa T, and Isobe KI. A NF-{kappa}B p65 subunit is indispensable for activating manganese superoxide: dismutase gene transcription mediated by tumor necrosis factor-alpha. J Cell Biochem 77: 474–486, 2000.[CrossRef][ISI][Medline]
  25. Marber MS, Latchman DS, Walker JM, and Yellon DM. Cardiac stress protein elevation 24 hours after brief ischemia or heat stress is associated with resistance to myocardial infarction. Circulation 88: 1264–1272, 1993.[Abstract/Free Full Text]
  26. Martin-Martin B, Nabokina SM, Blasi J, Lazo PA, and Mollinedo F. Involvement of SNAP-23 and syntaxin 6 in human neutrophil exocytosis. Blood 96: 2574–2583, 2000.
  27. Maus U, von Grote K, Kuziel WA, Mack M, Miller EJ, Cihak J, Stangassinger M, Maus R, Schlondorff D, Seeger W, and Lohmeyer J. The role of CC chemokine receptor 2 in alveolar monocyte and neutrophil immigration in intact mice. Am J Respir Crit Care Med 166: 268–273, 2002.[Abstract/Free Full Text]
  28. Mollinedo F, Martin-Martin B, Calafat J, Nabokina SM, and Lazo PA. Role of vesicle-associated membrane protein-2, through q-soluble N-ethylmaleimide-sensitive factor attachment protein receptor/r-soluble N-ethylmaleimide-sensitive factor attachment protein receptor interaction, in the exocytosis of specific and tertiary granules of human neutrophils. J Immunol 170: 1034–1042, 2003.[Abstract/Free Full Text]
  29. Nelson SK, Wong GH, and McCord JM. Leukemia inhibitory factor and tumor necrosis factor induce manganese superoxide dismutase and protect rabbit hearts from reperfusion injury. J Mol Cell Cardiol 27: 223–229, 1995.[ISI][Medline]
  30. Nitobe J, Yamaguchi S, Okuyama M, Nozaki N, Sata M, Miyamoto T, Takeishi Y, Kubota I, and Tomoike H. Reactive oxygen species regulate FLICE inhibitory protein (FLIP) and susceptibility to Fas-mediated apoptosis in cardiac myocytes. Cardiovasc Res 57: 119–128, 2003.[Abstract/Free Full Text]
  31. Oyama J, Blais C Jr, Liu X, Pu M, Kobzik L, Kelly RA, and Bourcier T. Reduced myocardial ischemia-reperfusion injury in toll-like receptor 4-deficient mice. Circulation 109: 784–789, 2004.[Abstract/Free Full Text]
  32. Poon BY, Ward CA, Cooper CB, Giles WR, Burns AR, and Kubes P. Alpha(4)-integrin mediates neutrophil free radical injury to cardiac myocytes. J Cell Biol 152: 857–866, 2001.[Abstract/Free Full Text]
  33. Poon BY, Ward CA, Giles WR, and Kubes P. Emigrated neutrophils regulate ventricular contractility via {alpha}4 integrin. Circ Res 84: 1245–1251, 1999.[Abstract/Free Full Text]
  34. Puri KD, Doggett TA, Douangpanya J, Hou Y, Tino WT, Wilson T, Graf T, Clayton E, Turner M, Hayflick JS, and Diacovo TG. Mechanisms and implications of phosphoinositide 3-kinase delta in promoting neutrophil trafficking into inflamed tissue. Blood 103: 3448–3456, 2004.[Abstract/Free Full Text]
  35. Remer KA, Brcic M, and Jungi TW. Toll-like receptor-4 is involved in eliciting an LPS-induced oxidative burst in neutrophils. Immunol Lett 85: 75–80, 2002.
  36. Rock MT, Dix AR, Brooks WH, and Roszman TL. ß1 integrin-mediated T cell adhesion and cell spreading are regulated by calpain. Exp Cell Res 261: 260–270, 2000.[CrossRef][ISI][Medline]
  37. Romanic AM, Harrison SM, Bao W, Burns-Kurtis CL, Pickering S, Gu J, Grau E, Mao J, Sathe GM, Ohlstein EH, and Yue TL. Myocardial protection from ischemia/reperfusion injury by targeted deletion of matrix metalloproteinase-9. Cardiovasc Res 54: 549–558, 2002.[Abstract/Free Full Text]
  38. Schwartz SM, Duffy JY, Pearl JM, Goins S, Wagner CJ, and Nelson DP. Glucocorticoids preserve calpastatin and troponin I during cardiopulmonary bypass in immature pigs. Pediatr Res 54: 91–97, 2003.[ISI][Medline]
  39. Strohm C, Barancik M, von Bruehl M, Strniskova M, Ullmann C, Zimmermann R, and Schaper W. Transcription inhibitor actinomycin-D abolishes the cardioprotective effect of ischemic preconditioning. Cardiovasc Res 55: 602–618, 2002.[Abstract/Free Full Text]
  40. Takaesu G, Surabhi RM, Park KJ, Ninomiya-Tsuji J, Matsumoto K, and Gaynor RB. TAK1 is critical for I{kappa}B kinase-mediated activation of the NF-{kappa}B pathway. J Mol Biol 326: 105–115, 2003.[CrossRef][Medline]
  41. Temple R, Allen E, Fordham J, Schneider HC, Lindauer K, Hayes I, Lockey J, Pollock K, and Jupp R. Microarray analysis of eosinophils reveals a number of candidate survival and apoptosis genes. Am J Respir Cell Mol Biol 25: 425–433, 2001.[Abstract/Free Full Text]
  42. Teoh N, Leclercq I, Pena AD, and Farrell G. Low-dose TNF-alpha protects against hepatic ischemia-reperfusion injury in mice: implications for preconditioning. Hepatology 37: 118–128, 2003.[CrossRef][ISI][Medline]
  43. Tsan MF, Clark RN, Goyert SM, and White JE. Induction of TNF-{alpha} and MnSOD by endotoxin: role of membrane CD14 and toll-like receptor-4. Am J Physiol Cell Physiol 280: C1422–C1430, 2001.[Abstract/Free Full Text]
  44. Utting O, Sedgmen BJ, Watts TH, Shi X, Rottapel R, Iulianella A, Lohnes D, and Veillette A. Immune functions in mice lacking Clnk, an SLP-76-related adaptor expressed in a subset of immune cells. Mol Cell Biol 24: 6067–6075, 2004.[Abstract/Free Full Text]
  45. Van Molle W, Wielockx B, Mahieu T, Takada M, Taniguchi T, Sekikawa K, and Libert C. HSP70 protects against TNF-induced lethal inflammatory shock. Immunity 16: 685–695, 2002.[CrossRef][ISI][Medline]
  46. Wang W, Schulze CJ, Suarez-Pinzon WL, Dyck JR, Sawicki G, and Schulz R. Intracellular action of matrix metalloproteinase-2 accounts for acute myocardial ischemia and reperfusion injury. Circulation 106: 1543–1549, 2002.[Abstract/Free Full Text]
  47. Wong GH and Goeddel DV. Induction of manganous superoxide dismutase by tumor necrosis factor: possible protective mechanism. Science 242: 941–944, 1988.[Abstract/Free Full Text]
  48. Xuan YT, Tang XL, Banerjee S, Takano H, Li RC, Han H, Qiu Y, Li JJ, and Bolli R. Nuclear factor-kB plays an essential role in the late phase of ischemic preconditioning in conscious rabbits. Circ Res 84: 1095–1109, 1999.[Abstract/Free Full Text]
  49. Yamashita N, Hoshida S, Otsu K, Taniguchi N, Kuzuya T, and Hori M. The involvement of cytokines in the second window of ischemic preconditioning. Br J Pharmacol 131: 415–422, 2000.[CrossRef][ISI][Medline]



This article has been cited by other articles:


Home page
Cardiovasc ResHome page
D. J. Hausenloy and D. M. Yellon
Remote ischaemic preconditioning: underlying mechanisms and clinical application
Cardiovasc Res, August 1, 2008; 79(3): 377 - 386.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
E. Lucchinetti, J. Aguirre, J. Feng, M. Zhu, M. Suter, D. R. Spahn, L. Harter, and M. Zaugg
Molecular Evidence of Late Preconditioning After Sevoflurane Inhalation in Healthy Volunteers
Anesth. Analg., September 1, 2007; 105(3): 629 - 640.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
S. Arab, I. E. Konstantinov, C. Boscarino, E. Cukerman, A. Mori, J. Li, P. P. Liu, A. N. Redington, and J. G. Coles
Early gene expression profiles during intraoperative myocardial ischemia-reperfusion in cardiac surgery
J. Thorac. Cardiovasc. Surg., July 1, 2007; 134(1): 74 - 81.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
D. J Hausenloy and D. M Yellon
The evolving story of "conditioning" to protect against acute myocardial ischaemia-reperfusion injury
Heart, June 1, 2007; 93(6): 649 - 651.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. R. Schmidt, M. Smerup, I. E. Konstantinov, M. Shimizu, J. Li, M. Cheung, P. A. White, S. B. Kristiansen, K. Sorensen, V. Dzavik, et al.
Intermittent peripheral tissue ischemia during coronary ischemia reduces myocardial infarction through a KATP-dependent mechanism: first demonstration of remote ischemic perconditioning
Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1883 - H1890.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
R K Kharbanda, J Li, I E Konstantinov, M M H Cheung, P A White, H Frndova, J Stokoe, P Cox, M Vogel, G Van Arsdell, et al.
Remote ischaemic preconditioning protects against cardiopulmonary bypass-induced tissue injury: a preclinical study
Heart, October 1, 2006; 92(10): 1506 - 1511.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. M.H. Cheung, R. K. Kharbanda, I. E. Konstantinov, M. Shimizu, H. Frndova, J. Li, H. M. Holtby, P. N. Cox, J. F. Smallhorn, G. S. Van Arsdell, et al.
Randomized Controlled Trial of the Effects of Remote Ischemic Preconditioning on Children Undergoing Cardiac Surgery: First Clinical Application in Humans
J. Am. Coll. Cardiol., June 6, 2006; 47(11): 2277 - 2282.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
I. E. Konstantinov and A. N. Redington
Linking gene expression, nuclear factor kappa B, remote ischemic preconditioning, and transplantation: A quest for an elusive Holy Grail or a road to an amazing discovery?
J. Thorac. Cardiovasc. Surg., February 1, 2006; 131(2): 507 - 509.
[Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
I. E. Konstantinov, S. Arab, J. Li, J. G. Coles, C. Boscarino, A. Mori, E. Cukerman, F. Dawood, M. M.H. Cheung, M. Shimizu, et al.
The remote ischemic preconditioning stimulus modifies gene expression in mouse myocardium
J. Thorac. Cardiovasc. Surg., November 1, 2005; 130(5): 1326 - 1332.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. Seeburger, J. Hoffmann, H. P. Wendel, G. Ziemer, and H. Aebert
Gene Expression Changes in Leukocytes During Cardiopulmonary Bypass Are Dependent on Circuit Coating
Circulation, August 30, 2005; 112(9_suppl): I-224 - I-228.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
19/1/143    most recent
00046.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Konstantinov, I. E.
Right arrow Articles by Redington, A. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konstantinov, I. E.
Right arrow Articles by Redington, A. N.


HOME